control aav vector  (TaKaRa)

Journal: Nature

Article Title: Determinants of successful AAV-vectored delivery of HIV-1 bNAbs in early life

doi: 10.1038/s41586-025-09330-2

Figure Lengend Snippet: a , The three infants in Group 1 were treated intramuscularly (IM) at birth with the indicated dose of an AAV-1 vector expressing rh-eCD4-IgG2-LS. b , The three infants in Group 2 were treated intravenously (IV) at birth with the indicated dose of an AAV-8 vector expressing rh-eCD4-IgG2-LS. Four weeks later, the Group 2 macaques were injected IM with the same dose of the same AAV-1/rh-eCD4-IgG2-LS vector administered to the Group 1 animals. c , The three infants in Group 3 were injected IM at birth with the indicated dose of an AAV-8 vector expressing rh-3BNC117-IgG1-LS. As the nine infants in Groups 1–3 approached 20 weeks of age, a per-protocol transition to paired housing necessitated the removal of one animal from the study. Because serum concentrations of rh-3BNC117-IgG1-LS had fallen below detection limits after week 12 in the Group 3 infant rh3-3, this animal was removed from the study. d , The six AAV vector-naïve infants in Group 4 were matched in age to those in Groups 1–3. Beginning at postnatal weeks 30–34, all the AAV-treated RMs in Groups 1–3 (except for rh3-3) and the Group 4 controls were subjected to weekly oral challenges with escalating doses of SHIV-AD8 EO .

Article Snippet: Both groups were inoculated intramuscularly with the same AAV-8-rh-3BNC117-IgG1-LS vector used in group 3, since AAV-expressed rh-3BNC117-IgG1-LS consistently elicits ADAs in most older monkeys , .

Techniques: Plasmid Preparation, Expressing, Injection

Journal: Nature

Article Title: Determinants of successful AAV-vectored delivery of HIV-1 bNAbs in early life

doi: 10.1038/s41586-025-09330-2

Figure Lengend Snippet: a – i , Serum concentrations of rh-eCD4-IgG2-LS ( a – f ) or rh-3BNC117-IgG1-LS ( g – i ) and ADA levels ( a – i ) in infant rhesus macaques in group 1 (rh1-1 ( a ), rh1-2 ( b ) and rh1-3 ( c )), group 2 (rh2-1 ( d ), rh2-2 ( e ) and rh2-3 ( f )), and group 3 (rh3-1 ( g ), rh3-2 ( h ) and rh3-3 ( i )). ADA responses for groups 1–3 are depicted as the serum immunoglobulin reactivity (absorbance values at 450 nm ( A 450 nm )) against plate-bound rh-eCD4-IgG2-LS or rh-3BNC117-IgG1-LS. j , Kaplan–Meier analysis of SHIV acquisition in each experimental group (groups 1–3) versus the control group (group 4) after oral challenges with increasing doses of SHIV-AD8 EO expressed as Gag p27 content. P values were calculated using the Mantel–Cox test. k , l , log 10 -transformed plasma viral loads in the group 4 macaques ( n = 6) ( k ) and in the only group 1 ( l ) monkey (rh1-1) that acquired infection. Empty red bars in l indicate the post-infection serum rh-eCD4-IgG2-LS concentrations.

Article Snippet: Both groups were inoculated intramuscularly with the same AAV-8-rh-3BNC117-IgG1-LS vector used in group 3, since AAV-expressed rh-3BNC117-IgG1-LS consistently elicits ADAs in most older monkeys , .

Techniques: Control, Transformation Assay, Clinical Proteomics, Infection

Journal: Nature

Article Title: Determinants of successful AAV-vectored delivery of HIV-1 bNAbs in early life

doi: 10.1038/s41586-025-09330-2

Figure Lengend Snippet: Sera from the macaques in Group 1 (a-c) , Group 2 (d-f) , and Group 3 (g,h) were tested for their ability to neutralize the in vitro infectivity of SHIV-AD8 EO in TZM-bl cells. Neutralizing titers [i.e., inhibitory dilutions at which 50% of neutralization (ID 50 ) was observed] were derived from these assays and plotted against the right y-axis of each panel. As a reference, the serum concentrations of rh-eCD4-IgG2-LS ( a-f ) or rh-3BNC117-IgG1-LS ( g,h ) were plotted against the left y-axis. Sera from the Group 3 macaque rh3-3 were not assayed for anti-SHIV-AD8 EO neutralizing antibodies because this animal was euthanized before the start of the oral SHIV challenge phase (gray shaded boxes).

Article Snippet: Both groups were inoculated intramuscularly with the same AAV-8-rh-3BNC117-IgG1-LS vector used in group 3, since AAV-expressed rh-3BNC117-IgG1-LS consistently elicits ADAs in most older monkeys , .

Techniques: In Vitro, Infection, Neutralization, Derivative Assay

Journal: Nature

Article Title: Determinants of successful AAV-vectored delivery of HIV-1 bNAbs in early life

doi: 10.1038/s41586-025-09330-2

Figure Lengend Snippet: a – j , The AAV-8-rh-3BNC117-IgG1-LS vector was administered to rhesus macaques across four age groups: group 5 ( a , b ; 48 h, except for rh5-6 (see below)); group 6 ( c , d ; approximately 2 years); group 7 ( e , f ; 4 weeks); group 8 ( g , h ; 8 weeks); and group 9 ( i , j ; 12 weeks). LLOQ, lower limit of quantification. a , c , e , g , i , Serum rh-3BNC117-IgG1-LS concentrations. b , d , f , h , j , Anti-rh-3BNC117-IgG1-LS responses, or ADAs, in each group. k , Serum concentrations of rh-3BNC117-IgG1-LS at week 20 in the group 5 newborns ( n = 5) and group 6 juveniles ( n = 6). l , Comparison of cumulative levels of ADAs produced by the group 5 newborns and group 6 juveniles during the 20 weeks of follow-up. AUC, area under the curve. In k , l , the group 5 infant rh5-6 was not included in the comparisons because it received the AAV-8-rh-3BNC117-IgG1-LS vector 4 weeks after birth. m , Monkeys in groups 3 and 5–9 were divided into three age brackets and their serum rh-3BNC117-IgG1-LS concentrations at week 20 were compared. In k – m , bars correspond to medians and P values were two-sided and calculated using the Mann–Whitney U -test. P values in brackets were calculated without the group 6 outlier rh6-6. n , Correlation between the age (in weeks) of each monkey at the time of AAV inoculation and serum rh-3BNC117-IgG1-LS concentration at week 20.

Article Snippet: Both groups were inoculated intramuscularly with the same AAV-8-rh-3BNC117-IgG1-LS vector used in group 3, since AAV-expressed rh-3BNC117-IgG1-LS consistently elicits ADAs in most older monkeys , .

Techniques: Plasmid Preparation, Comparison, Produced, MANN-WHITNEY, Concentration Assay

Journal: Nature

Article Title: Determinants of successful AAV-vectored delivery of HIV-1 bNAbs in early life

doi: 10.1038/s41586-025-09330-2

Figure Lengend Snippet: Total IgG reactivity to the AAV-8 capsid was measured by ELISA using a fixed dilution (1:1,000) of serum collected at baseline (day 0) and every two weeks thereafter until the last follow up at week 20. All samples from the Group 5 ( n = 6; a ) and Group 6 ( n = 6; b ) animals were tested in the same 384-well ELISA plate and the absorbance values measured at 450 nm for each sample were plotted against time. c , Geometric means of absorbance values measured for Group 5 (yellow hexagons) and Group 6 (gray hexagons) were plotted against time. The two-sided P value was calculated using the Mann-Whitney U test and resulted from comparing Groups 5 and 6 in terms of their cumulative levels of anti-AAV-8 IgG reactivity (area under curve analysis of absorbance values) measured over the 20 weeks of follow-up.

Article Snippet: Both groups were inoculated intramuscularly with the same AAV-8-rh-3BNC117-IgG1-LS vector used in group 3, since AAV-expressed rh-3BNC117-IgG1-LS consistently elicits ADAs in most older monkeys , .

Techniques: Enzyme-linked Immunosorbent Assay, MANN-WHITNEY

Journal: Nature

Article Title: Determinants of successful AAV-vectored delivery of HIV-1 bNAbs in early life

doi: 10.1038/s41586-025-09330-2

Figure Lengend Snippet: Sixteen pregnant female rhesus macaques at similar gestational stages were selected on the basis of having little or no serum reactivity to AAV-8 by ELISA. These animals were then divided into three groups depending on whether they were treated with recombinant forms of rh-3BNC117-IgG1. The Group A dams ( n = 8) received no bNAb infusion and underwent cesarean (c)-section when their pregnancies reached term at gestational week 24. The only exceptions were dams rhA-1 and rhA-3, which delivered their babies vaginally ahead of schedule. The dams in Groups B and C ( n = 4 each) were treated intravenously with 30 mg/kg of recombinant rh-3BNC117-IgG1-LS or rh-3BNC117-IgG1, respectively, at gestational week 22 and then underwent c-section two weeks later. The offspring of the dams in Groups A-C were transferred to the nursery after birth and then assigned to Groups 7–11. The infants in Groups 7–11 were treated intramuscularly (IM) with 2.0 × 10 12 genome copies ml –1 of an AAV-8/rh-3BNC117-IgG1-LS vector at postnatal weeks 4, 8, or 12, as depicted.

Article Snippet: Both groups were inoculated intramuscularly with the same AAV-8-rh-3BNC117-IgG1-LS vector used in group 3, since AAV-expressed rh-3BNC117-IgG1-LS consistently elicits ADAs in most older monkeys , .

Techniques: Enzyme-linked Immunosorbent Assay, Recombinant, Plasmid Preparation

Journal: Nature

Article Title: Determinants of successful AAV-vectored delivery of HIV-1 bNAbs in early life

doi: 10.1038/s41586-025-09330-2

Figure Lengend Snippet: a-h , Serum concentrations of rh-3BNC117-IgG1-LS or rh-3BNC117-IgG1 in the Group B (a-d) and Group C (e-h) dams following passive infusion of 30 mg/kg these molecules at gestational week 22 (vertical dotted lines). Two weeks later, pregnancies reached term and the animals underwent cesarean (c)-section (vertical solid line). The last two weeks of pregnancy are indicated by a gray box. i , Table listing the concentrations of rh-3BNC117-IgG1-LS or rh-3BNC117-IgG1 in maternal, cord blood, or newborn serum at the time of c-section.

Article Snippet: Both groups were inoculated intramuscularly with the same AAV-8-rh-3BNC117-IgG1-LS vector used in group 3, since AAV-expressed rh-3BNC117-IgG1-LS consistently elicits ADAs in most older monkeys , .

Techniques:

Journal: Nature

Article Title: Determinants of successful AAV-vectored delivery of HIV-1 bNAbs in early life

doi: 10.1038/s41586-025-09330-2

Figure Lengend Snippet: While the macaques in groups 10 and 11 were in their final weeks of gestation, their mothers were treated intravenously with recombinant rh-3BNC117-IgG1-LS or rh-3BNC117-IgG1, leading to transplacental transfer of these molecules. The macaques that were prenatally exposed to the bNAb were delivered two weeks later and then treated with the AAV-8-rh-3BNC117-IgG1-LS vector at 8 weeks (group 10) or 12 weeks (group 11) of age. a , c , Serum rh-3BNC117-IgG1-LS concentrations in group 10 ( a ) and group 11 ( c ). ADAs were assessed as described in Fig. for group 10 ( b ) and group 11 ( d ). All samples from groups 7–11 were screened for anti-rh-3BNC117-IgG1-LS antibodies in the same 384-well enzyme-linked immunosorbent assay (ELISA) plate. e , f , Cumulative serum rh-3BNC117-IgG1-LS concentrations ( e ) and ADA levels (absorbance values of anti-rh-3BNC117-IgG1-LS reactivity in serum) ( f ) measured over the first 20 weeks post-intervention were compared between infant macaques exposed to recombinant forms of rh-3BNC117-IgG1 in utero (groups 10 and 11) and age-matched bNAb-naive infants (groups 8 and 9). Bars correspond to medians. All P values were two-sided and calculated using the Mann–Whitney U -test.

Article Snippet: Both groups were inoculated intramuscularly with the same AAV-8-rh-3BNC117-IgG1-LS vector used in group 3, since AAV-expressed rh-3BNC117-IgG1-LS consistently elicits ADAs in most older monkeys , .

Techniques: Recombinant, Plasmid Preparation, Enzyme-linked Immunosorbent Assay, In Utero, MANN-WHITNEY

Journal: Nature

Article Title: Determinants of successful AAV-vectored delivery of HIV-1 bNAbs in early life

doi: 10.1038/s41586-025-09330-2

Figure Lengend Snippet: Four out of the seven AAV-treated macaques in groups 1–3 that resisted oral challenges with SHIV-AD8 EO were kept alive for up to four years, and AAV-driven transgene expression in serum was monitored. These macaques were not re-dosed with AAV vectors after the neonatal period. a – d , Serum concentrations of rh-3BNC117-IgG1-LS ( a , b ) or rh-eCD4-IgG2-LS ( c , d ) and NAb titres against SHIV-AD8 EO for rh3-1 ( a ), rh3-2 ( b ), rh1-2 ( c ), and rh2-3 ( d ). Date of birth (DOB) and date of the last rh-3BNC117-IgG1-LS or rh-eCD4-IgG2-LS measurement are shown. ID 50 , half-maximal infectious dose. e – i , The six macaques in group 5 were kept alive beyond the 20-week follow-up period described in Fig. and their serum concentrations of rh-3BNC117-IgG1-LS ( e ) and NAb titres against SHIV-AD8 EO ( f ) were monitored until the animals reached approximately 2.5 years of age. Beginning at weeks 133–140 post-intervention, the group 5 monkeys and six controls (group 12) were subjected to repeated intrarectal (IR) challenges with a fixed marginal dose of SHIV-AD8 EO . g , Kaplan–Meier analysis of SHIV acquisition in groups 5 and 12. The P value was calculated using the Mantel–Cox test. h , i , Plasma viral loads in the group 12 macaques ( n = 6) ( h ) and in the only group 5 monkey (rh5-2) ( i ) that acquired infection.

Article Snippet: Both groups were inoculated intramuscularly with the same AAV-8-rh-3BNC117-IgG1-LS vector used in group 3, since AAV-expressed rh-3BNC117-IgG1-LS consistently elicits ADAs in most older monkeys , .

Techniques: Expressing, Clinical Proteomics, Infection

Journal: Immunity, Inflammation and Disease

Article Title: MiR‐146a Reduces Inflammation in Experimental Pancreatitis via the TRAF6–NF‐κB Signaling Pathway in Mice

doi: 10.1002/iid3.70163

Figure Lengend Snippet: Effects of miR‐146a on enzymatic changes in AP mice. (A) The expression of miR‐146a after treatment with AAV. (B) Design of the mouse experiment (PBS + NS group ( n = 8), PBS + Cn group ( n = 8), miR‐146a + Cn group ( n = 8), miR‐146a‐sponge + Cn (group n = 8); caerulein, 50 μg/kg, 10 intraperitoneal injections). (C) Serum amylase and (D) lipase activities are shown. PBS + NS: PBS and saline treatment. PBS + Cn: PBS and caerulein treatment. MiR‐146a + Cn: miR‐146a overexpression and caerulein treatment. MiR‐146a‐sponge + Cn: miR‐146a‐sponge and caerulein treatment. Data shown are the means ± SEM. * p < 0.05, ** p < 0.01.

Article Snippet: The pAAV9‐U6‐GFP (adeno‐associated virus (AAV)) vectors carrying miR‐146a‐5p (MIMAT0000158; GATCCGTGAGAACTGAATTCCATGGGTTTCAAGAGAACCCATGGAATTCAGTTCTCATTTTTTA), miR‐146a‐5p sponge (MIMAT0000158; CGCAACCCATGGAAATAGTTCTCAGGGTCCCAACCCATGGAAATAGTTCTCAGGGTCCCAACCCATGGAAATAGTTCTCAGGGTCCCAACCCATGGAAATAGTTCTCAA) or a negative control were generated (Vigene Bioscience, Jinan, China).

Techniques: Expressing, Saline, Over Expression

Journal: Immunity, Inflammation and Disease

Article Title: MiR‐146a Reduces Inflammation in Experimental Pancreatitis via the TRAF6–NF‐κB Signaling Pathway in Mice

doi: 10.1002/iid3.70163

Figure Lengend Snippet: Pathological changes in the pancreas and lungs in AP ( n = 8 for each group). (A) Pancreas and lung histology (×200). (B) Pancreas pathology scores and (C) lung histology scores in mice are shown. PBS + NS: saline treatment. PBS + Cn: caerulein treatment. MiR‐146a + Cn: miR‐146a overexpression and caerulein treatment. MiR‐146a‐sponge + Cn: miR‐146a‐sponge and caerulein treatment. Data shown are the means ± SEM. * p < 0.05.

Article Snippet: The pAAV9‐U6‐GFP (adeno‐associated virus (AAV)) vectors carrying miR‐146a‐5p (MIMAT0000158; GATCCGTGAGAACTGAATTCCATGGGTTTCAAGAGAACCCATGGAATTCAGTTCTCATTTTTTA), miR‐146a‐5p sponge (MIMAT0000158; CGCAACCCATGGAAATAGTTCTCAGGGTCCCAACCCATGGAAATAGTTCTCAGGGTCCCAACCCATGGAAATAGTTCTCAGGGTCCCAACCCATGGAAATAGTTCTCAA) or a negative control were generated (Vigene Bioscience, Jinan, China).

Techniques: Saline, Over Expression

Journal: Immunity, Inflammation and Disease

Article Title: MiR‐146a Reduces Inflammation in Experimental Pancreatitis via the TRAF6–NF‐κB Signaling Pathway in Mice

doi: 10.1002/iid3.70163

Figure Lengend Snippet: MiR‐146a affects inflammation in AP ( n = 8 for each group). (A) The expression of MPO in pancreatic and lung tissue (×200). (B) The MPO immunohistochemistry score in pancreatic and lung tissue. (C) The expression of inflammatory cytokines (TNF‐α, IL‐1β, and IL‐6) in pancreatic tissue. PBS + NS: saline treatment. PBS + Cn: caerulein treatment. MiR‐146a + Cn: miR‐146a overexpression and caerulein treatment. MiR‐146a‐sponge + Cn: miR‐146a‐sponge and caerulein treatment. Data shown are the means ± SEM. * p < 0.05, ** p < 0.01.

Article Snippet: The pAAV9‐U6‐GFP (adeno‐associated virus (AAV)) vectors carrying miR‐146a‐5p (MIMAT0000158; GATCCGTGAGAACTGAATTCCATGGGTTTCAAGAGAACCCATGGAATTCAGTTCTCATTTTTTA), miR‐146a‐5p sponge (MIMAT0000158; CGCAACCCATGGAAATAGTTCTCAGGGTCCCAACCCATGGAAATAGTTCTCAGGGTCCCAACCCATGGAAATAGTTCTCAGGGTCCCAACCCATGGAAATAGTTCTCAA) or a negative control were generated (Vigene Bioscience, Jinan, China).

Techniques: Expressing, Immunohistochemistry, Saline, Over Expression

Journal: Immunity, Inflammation and Disease

Article Title: MiR‐146a Reduces Inflammation in Experimental Pancreatitis via the TRAF6–NF‐κB Signaling Pathway in Mice

doi: 10.1002/iid3.70163

Figure Lengend Snippet: MiR‐146a regulates inflammation via the NF‐κB signaling pathway in AP. (A) The expression of P‐P65 and IκBα (×200) and (B) score in the pancreas are shown. (C) Immunofluorescence staining analysis of P65 in the pancreas is shown (×200). PBS + NS: saline treatment. PBS + Cn: caerulein treatment. MiR‐146a + Cn: miR‐146a overexpression and caerulein treatment. MiR‐146a‐sponge + Cn: miR‐146a‐sponge and caerulein treatment. Data shown are the means ± SEM. * p < 0.05, ** p < 0.01.

Article Snippet: The pAAV9‐U6‐GFP (adeno‐associated virus (AAV)) vectors carrying miR‐146a‐5p (MIMAT0000158; GATCCGTGAGAACTGAATTCCATGGGTTTCAAGAGAACCCATGGAATTCAGTTCTCATTTTTTA), miR‐146a‐5p sponge (MIMAT0000158; CGCAACCCATGGAAATAGTTCTCAGGGTCCCAACCCATGGAAATAGTTCTCAGGGTCCCAACCCATGGAAATAGTTCTCAGGGTCCCAACCCATGGAAATAGTTCTCAA) or a negative control were generated (Vigene Bioscience, Jinan, China).

Techniques: Expressing, Immunofluorescence, Staining, Saline, Over Expression

Journal: Immunity, Inflammation and Disease

Article Title: MiR‐146a Reduces Inflammation in Experimental Pancreatitis via the TRAF6–NF‐κB Signaling Pathway in Mice

doi: 10.1002/iid3.70163

Figure Lengend Snippet: The mechanism of miRNA‐146a regulation in AP via the TRAF6–NF‐κB signaling pathway. Immunofluorescence staining analysis of TRAF6 and P‐IKKα/β in the pancreas is shown (×200). PBS + NS: saline treatment. PBS + Cn: caerulein treatment. MiR‐146a + Cn: miR‐146a overexpression and caerulein treatment. MiR‐146a‐sponge + Cn: miR‐146a‐sponge and caerulein treatment.

Article Snippet: The pAAV9‐U6‐GFP (adeno‐associated virus (AAV)) vectors carrying miR‐146a‐5p (MIMAT0000158; GATCCGTGAGAACTGAATTCCATGGGTTTCAAGAGAACCCATGGAATTCAGTTCTCATTTTTTA), miR‐146a‐5p sponge (MIMAT0000158; CGCAACCCATGGAAATAGTTCTCAGGGTCCCAACCCATGGAAATAGTTCTCAGGGTCCCAACCCATGGAAATAGTTCTCAGGGTCCCAACCCATGGAAATAGTTCTCAA) or a negative control were generated (Vigene Bioscience, Jinan, China).

Techniques: Immunofluorescence, Staining, Saline, Over Expression

Journal: Immunity, Inflammation and Disease

Article Title: MiR‐146a Reduces Inflammation in Experimental Pancreatitis via the TRAF6–NF‐κB Signaling Pathway in Mice

doi: 10.1002/iid3.70163

Figure Lengend Snippet: MiR‐146a affects AP in different animal models. (A) Pancreas histology in AP mice mediated by caerulein combined with LPS and (B) l ‐arginine is shown (×200). PBS + NS: saline treatment. PBS + Cn + LPS: caerulein and LPS treatment. MiR‐146a + Cn + LPS: miR‐146a overexpression and caerulein and LPS treatment. MiR‐146a‐sponge + Cn + LPS: miR‐146a‐sponge and caerulein and LPS treatment. PBS + l ‐arginine: l ‐arginine treatment. MiR‐146a + l ‐arginine: miR‐146a overexpression and l ‐arginine treatment. MiR‐146a‐sponge + l ‐arginine: miR‐146a‐sponge and l ‐arginine treatment. Data shown are the means ± SEM. ** p < 0.01, *** p < 0.001.

Article Snippet: The pAAV9‐U6‐GFP (adeno‐associated virus (AAV)) vectors carrying miR‐146a‐5p (MIMAT0000158; GATCCGTGAGAACTGAATTCCATGGGTTTCAAGAGAACCCATGGAATTCAGTTCTCATTTTTTA), miR‐146a‐5p sponge (MIMAT0000158; CGCAACCCATGGAAATAGTTCTCAGGGTCCCAACCCATGGAAATAGTTCTCAGGGTCCCAACCCATGGAAATAGTTCTCAGGGTCCCAACCCATGGAAATAGTTCTCAA) or a negative control were generated (Vigene Bioscience, Jinan, China).

Techniques: Saline, Over Expression